On the Edge of Eureka

To be a utopia, one must eliminate the wrong.

To eliminate the wrong makes a dystopia.

Eleutheria is a paradox.

Dalia is at the pinnacle of human evolution. In a world where entire populations can be subdued with the touch of a button, she holds the key to destroying the planet- or saving it. Leading a double life, she's the picture of a perfect leader- and a perfect rebel. But when her childhood best friend joins a dangerous movement that goes against everything Dalia stands for, it all goes south.

Warring political parties demand change for all the wrong reasons. A planetwide revolt ends in tragedy. And life from beyond the solar system slowly inches closer, but their intentions are unknown and they themselves are dangerous.

Dalia finds herself running with people she'd never thought she'd meet, shooting down people she'd never thought she'd hate, and fighting against a city she thought she'd always love- and in the end, it might not even matter.

1Likes
0Comments
2596Views
AA

11. Inopinatum

Dalia stared at the map of the city. Holographic buildings glowed in blue. Occasionally one would blink and fade out of the map, leaving an empty dark spot. Patches without light symbolizes areas that had been destroyed.

There were an awful lot of places without light.

The world Dalia had been thrust into was much different than her usual glamour; instead of gleaming with sparkles, the whole place had a sort of military precision. She preferred to stay on the Revelation instead of here, but with the ship docked so far above that just wasn't realistic. So she settled on smaller quarters- much less than she'd been used to. 

She hated herself for hating it.

All around her were people she hadn't seen in reality for years. Somehow, she just associated them with the personas their messages seemed to convey; Atlas had sounded like a younger man, and she always pictured him as broad and tall- he was in his eighties and five-foot-six. 

He had been one of the founding members of the Revolution way back when, but was now too old to do much of anything. Soldiers had accelerated lifespans; death came sooner for them than it did for the rest, but so did adulthood and fighting capability. 

Another area of the map fizzled and died.

"We're dismissing more troops," Artemis said. She had been an author, but ill-suited for the position- she liked to be in control, Dalia noticed. 

"How bad is it up there?" she asked.

"Elysia is completely decimated," Artemis sighed. "The fighting's pushing past the border of Terra now. Appalachia's in full on riot mode, and so is Ingis and Pacem."

Dalia winced. Even Pacem, the division of peace. "How many casualties?"

"Can't say yet."

"What are we going to do?"

"Don't know," Atlas said gruffly from the corner.

Dalia felt her communicator vibrate- a message from Athena. She picked it up and looked at it. 

They're coming closer, I guess because all the military is here they've been allowed in more. You know who I mean. Kalyn and Carina and me all see the same thing so I know it isn't just me. We don't need aliens abducting people on top of the planetwide rioting.

    
Dalia buried her head in her hands. There was no hope.

The buildings around the central terminal flickered and went dark.

***

Alestra leant back on her plush pillows. The good thing about chaos was that no one noticed she was missing. Behind her, a building toppled. Flames soared out of the heap of broken shards of steel. The high-pitched screams of its residents filled the air. 

Let the city burn. They'd rebuild it later. 

She sipped her wine. The fire was reflected in the crystalline glass.

Behind her, he soft whoosh of the lift sounded. Alestra barely registered the noise until she heard the telltale click of soldiers' boots on the floor. Turning quietly, she raised an eyebrow.

TB and Cassiopeia, that Generalis girl they'd recruited a few weeks ago. The two should have been out fighting. 

"Why are you-" she began, but then TB drew his gun. She barely had time to react before he shot her.

The thud of Alestra's corpse against the floor was louder than the sound of the laser itself. The shot was clean through her forehead, a charred hole of flesh no bigger than a pinhole- cover the face and she may as well have been sleeping. in death, she looked almost angelic; gray-white hair fanned around her face like a halo. Her expression was one of cold haughtiness.

TB snickered. Cass giggled and clung to his arm, but he shook her off, staring at the corpse like it was a prize. 

With Alestra gone, all her assets were his, especially withought her daughters in the picture. Absentmindedly, he wondered about Acidalia and Aleskynn- either they were already dead or would be soon. If they were alive- well, they'd be wishing for death by the time the Movement caught them. Or at least the older one would be. 

The little one had potential.

"What are you gonna do?" Cass asked from his left. "What does this mean?"

Idiot, TB thought. He fingered the trigger on his gun, toying with the idea of shooting her too and ending her excessive brown-nosing, but ultimately decided not to. Cassiopeia had her uses, foolish as she was, and it was never bad for his ego to have her around with her endless hero-worshipping.

"Wait," he told her. Alestra may have been rich, but that wasn't one of the reasons he assassinated her- there was something else.

Ciphers and their DNA terminals. There would be one in this room.

TB had long suspected that his neighbor in numbers had access to DNA transcripts. TB-2115- Tee?- was always fiddling around with them- a trick he'd probably learned from his sister, if TB was correct in assuming he and Acidalia were connected- but TB himself had never managed to hack into one. 2115 had always regarded them with reverence, but TB had no interest in listening to the arbitrary laws of his conscience.

"Do you have any idea what a DNA terminal looks like?" he asked Cassiopeia. He had learned the commands he needed to do what he wanted, but had never seen one in all its glory.

She shrugged. "Acidalia always had one down that way, I think."

TB stormed past her and down a hallway to Alestra's bedroom. Cass followed, excitedly twittering the entire way, stopping to admire exquisite gowns and products that lay draped all over the place. She didn't care about DNA modification, but it still felt good to dance around like she owned the penthouse; it wasn't all that much higher than Generalis, but it meant something so much more than simply being in the home of a Cipher. 

"Found it," TB yelled. Cass went over to him, half-skipping. He booted up the computer, knowing exactly which mods he wanted, and pulling out a strand of hair to place in the terminal.

AATAGCATAGTCAGTACCCCCGGGGGGTTACCCGCGGCGGGGGGAGAGCCGCGCGGATATATGGACGTACGATAGTAGGAGCGCGAGCGATCGACGCTGAGCTGATTAGACTAGCCGGTACGCGCGCGCGCGCGGCGCGCATGCATCGCGCGCGGCCGCGAGCGATACGATCGGTT...

Grinning widely, he selected a few thousand letters- Cass knitted her brow, confused. He erased them and copy-pasted something else, but it all looked like gibberish to her, meaningless letters, like computer code she'd never bothered to learn.

It was all the same, wasn't it? she thought. Humans were just like robots. Robots ran on programs, and that's all DNA was, a program written in four letters. And just like robots, some were better than others- just as a Class A Nanocore Android would forever be more advanced than the rudimentary computer in a thermostat, Cassiopeia e Nayla, Generalis, would always outrank the common Labora. 

It's in my code, she thought smugly, looking at her green-tinged skin. My ancestors were great, and I'm destined to be great, too.

TB grinned suddenly stood. With a loud bang, he brought his fist down on a fragile-looking endtable; it shattered, shards flying in all directions. When he raised his hand, fragments of broken glass stuck from his bloody, bruised skin, and he laughed, ignoring the wounds. Cass stared, confused. 

He whirled around again, smashing a mirror, kicking the wall, bruising his feet and never once wincing. 

Has he gone mad? Cass wondered.

TB punched the wall so hard he dented it. 

How did he do that?

He grabbed a holopad protector and bent it in half, effortlessly breaking it into two pieces. Shards of electronics and equipment lay scattered around the floor. TB picked up a chunk of precious amethyst- a laboratory-grown rock the size of Cass's head- and threw it against the floor with alarming strength, so hard it passed through the floor and left a hole.

He upped his strength, Cass recognized. And pain resistance, too. TB had made himself practically invincible.

She glowed. A consort to an invincible, superhuman man, the new leader of the Movement- Cassiopeia e Nayla, Generalis, had so many possibilies ahead of her it was an incredible thought. She would rule alongside him, a race of genetically superior beings. 

It was only right.

The world would belong to Cass soon, as it should. The Ciphers had fallen. Eleutheria was dying. Soon, a new regime would be put into place.

Some girls, once they reached majority, kept Servum around- attractive women, servants that did nothing but sit and look pretty and advertise one's wealth. But Servum were rare. Most only kept a few if at all.

Cass would have hundreds. Make all of them her Servum.

And men. Handsome men. If TB wasn't enough- the whole military of Eleutheria, or what was left of it, was under her command. They were hers. All hers.

TB grabbed her wrist so hard he almost snapped it, and she shrieked. He didn't seem to care. He didn't know his own strength. Blood trailed from his fists, but he didn't care.

High on the feeling of invincibility and assured the world was theirs, he stormed to the center of the room and pulled out his communicator cuff, typing out a message to all his followers. 

Alestra e Harmonia, Cipher, has been tragically killed in a Revolutionary attack on her apartment, likely by none other than her daughter Acidalia Planitia.

Cass seethed at Dalia's name. 

This woman is extraordinarily dangerous. She possesses standard Cipher abilities, but is known to have physcopathic and violent tendencies. Alestra left behind another daughter known as Aleskynn or "Leski" e Alestra, Outcaste. This young girl may be in the custody of her murderous sister. It is imperative that Acidalia be caught or neutralized before further harm comes to Aleskynn or other members of her family or social circle. If you have any knowledge of her whereabouts, it is necessary to inform me, as I have taken on the role of leader of the Loyalist Movement. Anyone to assassinate Acidalia Planitia will be rewarded. However, it is believed that Aleskynn possesses superior genetic material. Do not harm the girl.

    
"She does not!" Cass said indignantly. "Outcaste scum, that's what she is!"

"She doesn't have anything special," TB drawled, "but she's got the knowledge we need. And look at her- young, stupid, resentful; if she's still alive, she's be an easy recruit."

"Oh." So he had other plans for Aleskynn. "So what about Acidalia?"    

"What about her?" TB asked. "She's probably dead. It's a shame. I had plans for that woman."

"You wanted to recruit her?!"

"No," he said, smirking. "Every man needs a beautiful woman at his disposal, don't you agree?"

"I could be that," she whispered, hardly breathing.

"You're much too special," he said softly. "Your genes have a more important use. I don't foresee you agreeing with my fantasies."

"All of your fantasies are mine."

"Not these, beautiful." He stroked her cheek, and Cassiopeia felt something inside her burn before TB turned his attention away to the communicator cuff again. 

What fantasies? Cass thought.

"I need a new name," he said in a decisive growl. "TB-2116 is the name of a faceless soldier. Breeding stock and cannon fodder. The same as the scum of the world. That is not the name of a conquerer." 

"What will your title be?" she asked.

"We'll decide that later."

I, TB-2116, am claiming the position of Leader of the Loyalist Movement on the orders of Alestra e Harmonia in her final moments. This is non-negotiable.

Find the child and kill the Revoulutionary.

    
He ended his message with a swift whoosh. Cass felt her own cuff vibrate as it received his message.

Cass was elated. 

Beautiful. She was beautiful. She was better, more important than Dalia. It was written in her code to be a conquerer, and Acidalia Planitia's code was that of a glitch. It was inherent. Glitches must be destroyed.

The humans had risen over the other primates as the Loyalists rose over the rest of Eleutheria. Survival of the fittest. Darwinian evolution. A force of nature. Destiny.

Her destiny.

Join MovellasFind out what all the buzz is about. Join now to start sharing your creativity and passion
Loading ...