On the Edge of Eureka

To be a utopia, one must eliminate the wrong.

To eliminate the wrong makes a dystopia.

Eleutheria is a paradox.

Dalia is at the pinnacle of human evolution. In a world where entire populations can be subdued with the touch of a button, she holds the key to destroying the planet- or saving it. Leading a double life, she's the picture of a perfect leader- and a perfect rebel. But when her childhood best friend joins a dangerous movement that goes against everything Dalia stands for, it all goes south.

Warring political parties demand change for all the wrong reasons. A planetwide revolt ends in tragedy. And life from beyond the solar system slowly inches closer, but their intentions are unknown and they themselves are dangerous.

Dalia finds herself running with people she'd never thought she'd meet, shooting down people she'd never thought she'd hate, and fighting against a city she thought she'd always love- and in the end, it might not even matter.

1Likes
0Comments
2481Views
AA

4. Sedito

 

 

9/30/4871
Terabyte-Harpstring

SGFycHN0cmluZy0gdGhlIHRpbWUgaXMgdXBvbiB1cy4gQXJjaGFuZ2VsIHdpbGwgc2V0IHlvdSBmcmVlLiBUaGUgQWxiYXRyb3NzIHdpbGwgYmUgdW5kZXIgbXkgY29udHJvbCBieSB0b25pZ2h0LiBUcnVzdCB0aGUgc2VyYXBoaW0uIFRoZSBDaXBoZXJzIG11c3QgZmFsbC4gTG9uZyBsaXZlIHRoZSBtb3ZlbWVudC4=

translation:
Harpstring- the time is upon us. Archangel will set you free. The Albatross will be under my control by tonight. Trust the seraphim. The Ciphers must fall. Long live the movement.

Cassiopeia paced the room.

After the incident at Dalia's party, she had been removed quickly and placed here. She had expected a cell, but this was not a cell by any means; the room was pearly white with aquamarine accents. The bed was four-poster with a curtain surrounding it the same color as Dalia's hair. Beautiful gowns and accessories filled every wardrobe. It was the lap of luxury.

But Cass was still a prisoner.

She didn't think Dalia would have put her here; she was too self-righteous to give Cass special treatment. But there didn't seem to be anyone else.

And then there was TB's message. Terabyte- an outdated English term for something she vaguely remembered as being computer-related- was his secret codename. Her own was Harpstring. But she didn't recognize an Archangel or seraphim.

Cass sat on the edge of the bed. She had changed into a long white gown and combed out her hair, feeling very glamourous. There had been water, but no food; still, she had managed to keep herself full with the lights on the ceiling and the carbon dioxide in the air. There was a lot of carbon dioxide here.

She had deduced from the sight out her window that she was someplace on the Appalachia/Terra border. They hadn't told her where they were taking her. She was high up, too; only a few hundred floors down from where the Ciphers lived at most.The building next door was a robotics factory. Half-finished shells of androids looked at her from the window, uncanny-valley eyes staring at her. Plumes of smoke rose into the air. If she stuck her head out and breathed, the acrid smell of burning plastic and metal would burn her nose.

She sat on the floor again. After one got over the initial riches and tired of playing with fancy ballgowns, there really was very little to do. They had left her with her communicator cuff, but there wasn't much she could do with it outside of send messages, especially with such a low battery. No one had even mentioned the insignia of the Movement burned into the inside of her wrist.

Suddenly, the door swished open. Cass started. It wasn't Dalia, but she recognized her nonetheless: Alestra e Harmonia, Cipher. Dalia's mother.

But she didn't look angry in the slightest. Alestra greeted Cass with a serene smile, but something lurked underneath that peaceful expression- not malice, exactly, something else. Her pale-white skin made her blend in with the walls of the room as if she were a statue. She fit in perfectly with the luxurious room.

"Hello," Alestra said, gliding over to Cass. 

"What do you want with me?" she asked.

"I have a proposition," she replied. "A very complicated and morally gray proposition. But after your work with ketacyanide, well, it doesn't seem like that's out of the question."

"I didn't-" Cass began, but Alestra cut her off.

"Don't deny it," she said plainly. "I appreciate your bravery, but your subtlety needs work. It's lucky that there were others with the same compound, and the same target, to take your place if you were to fail."

Cass knitted her eyebrows. "What are you talking about?"

"I know a lot more of their secrets than you do," she said. "I am enlisting you in a project. I can't mention it here. I believe it is safe to say that you no longer have a friendly relationship with my eldest daughter?"

"Yes," Cass replied truthfully.

"I thought so. Now, what do you think of Aleskynn?"

"I don't know her."

"Maybe that's better. Follow me, Harpstring." Alestra stood up and went to leave.

Cass made a small sound of recognition, startled. Alestra held up her wrist.

"I am Archangel. Those like me are the seraphim. Long live the Movement."

***

"We can't just leave her there!" Ace protested. "She's barely sixteen! You can't just dump her on Mars!"

'Yes he can," Lyra said. "Martians- they don't care about Eleutherian castes. I could get a better job there, and-"

"Martians also have child labor laws," Ace said. 

"Well, we could just take her back to Eleutheria-" Tee began, but Lyra interrupted him. 

"No, you can't take me back there," she begged. "I can't go back now. Please, Mars, hell, even Venus, anywhere but back there."

"I do have a friend on Mars," Tee said thoughtfully. "More of an ally, really. He's called David Seren- he's old, though. Left Eleutheria when he knocked up a girl. He sympathizes with us. I think he has a daughter now.."

"That's perfect," Lyra said.

"I just don't know how to get you there," Tee sighed. "I'm high ranking, but the order would have to go through all my superiors- all three of them- and none of them know I'm- well," he finished lamely, "we'll talk about that later."

"What do you mean, David Seren sympathizes with you?" Lyra asked.

Tee sighed. "Loaded question. Wait a bit, and then I'll tell you when it's safe."

"That's a better idea," Ace agreed. "I mean, I'm okay with her being on Mars, just as long as she isn't alone."
Lyra glared at him. "You're a year older than me, at most! And I have no idea what you're doing, but I do know you're a soldier!"

"That's different," Ace said. "I'm not alone."

"You're being overprotective," she sighed.

"I don't like to see innocent people get hurt," he said. 

"I'm not innocent. I snuck onto a warship to become an illegal Martian immigrant."

"That's different than murder, or something. You aren't-"

"I'm not what?" Her eyes flashed dangerously. 

"Nothing," Ace said reassuringly. He looked at Lyra again. She was tiny- short, pale, skinny, looked like she hadn't eaten a good meal in weeks. Her hair was in a bubblegum pink, curly ponytail, and she wore a dress covered in sequins. She wasn't hardened or angry looking- she was cute. When he pictured the word threat, Lyra was the last image that came to mind.

"Don't underestimate me," she whispered. "I lived sixteen years in a scummy ground level slum filled with gang wars and drug addiction. I was raised by teenaged singers like me. I don't even know who my mother was. If I were as fragile as you seem to think I am, I'd be dead or worse."

"Okay," Ace said. "I believe you, I believe you. Just don't put yourself in more danger, all right? Once we get you to Mars where you're supposed to be, it'll be fine."

Lyra exhaled, and gone was the girl with the fiery eyes, replaced by the cute-looking innocent ballerina with pink hair. She was funny to him- one second frightened half to death by Tee, another gladly standing up to him. Maybe it was paranoia, he thought. She's always on her guard because on ground level, dropping it for one second can kill you.

"Okay," Lyra said. "Thank you. I just-"

Suddenly, the Albatross jolted. The trio went flying into the opposite wall. Ace and Tee were protected by their heavy armor, but Lyra hit the bunk post without any protection and crumpled to the floor. Worried, Ace went to help her up, but she stood on her own and sighed.

"Between the hovercar crash and this, my ribs are getting really sore."

Tee sat up rubbing his head where it had collided with the wall. "We just turned around, and suddenly. I didn't make that order."

"I bet it was a caste Generalis," Ace said darkly. Just by being born into the caste, those spoiled, prissy Eleutherian girls had the authority to intervene wherever they wanted- though most prefered to stay at home and have others risk their necks for them. 

Tee shook his head. "None of the full Generalis women would do that- I've met them, I know. There is Cassiopeia e Nayla, but she's only nineteen- she used to be friends with my older sister."

"Then something must have gone wrong, if you weren't notified as a Commander, and XA-7291 wouldn't have made that order."

"XA- what was that?" Lyra asked.

"We have numbers," Ace said, holding out his badge. "I'm not called Ace. AX-C61EM is my technical name. AX is for whatever batch of babies I was from, I think C signifies my birth year but I'm not sure how, 61 is my squad, E means... something, and M is rank, maybe? I don't know how it works."

"Wow," Lyra said. "Complicated."

"Yeah," Tee said, not paying attention. "Ace, let's go. I want to check this out."

"Wait here," Ace said to Lyra. They shut the door behind them, leaving Lyra alone in the bunkroom. It smelled like boys- body spray, sweat, mold, old shoes. Weapons were laid carelessly on the end table, and she could tell that they were fully charged from the way they were glowing. Lyra got the impression that the Eleutherian military wasn't as organized as it seemed to be to an outsider. As a girl, looking at the rows of marching soldiers, she had been patriotic, prideful, curious. They seemed untouchable and dangerous. Now, looking simply at the bunkroom of two soldiers- laser guns laying loaded on a desk, noxious smells and unmade beds, it looked like the abodes of all Lyra's fellow dancers- replace the dresses with old fatigues and it was a perfect picture.

At the end of a wall was a flat blank area without the posters that covered the rest of the wall. It struck Lyra as odd, because every other square inch of the room was covered with the names of bands or photos of random girls. 

She went over and put a hand on it, and suddenly it glowed to life- it was a screen, not a stretch of blank wall. Lyra clicked a little icon of a speech bubble, and a whole list of posts popped up- a chat room. Most of what to soldiers were saying was lewd nonsense, with an occasional smattering of irritated officers trying to discuss strategy over the never-ending stream of utter garbage. Every so often, someone would disappear and someone else would take their place.

Fascinated, she stared at it for a while as it updated in real time. She didn't recognize any of the soldiers' names- they were all numbers- but it was still entertaining. A man named TB-2116M popped up.

Tee? she wondered. But no- the last number on his badge was a 5, not a six. This guy must be one of his brothers, Lyra thought. Brothers- siblings- can you imagine?

She tapped on his tiny glowing face and was whisked away to a different screen, with fingerprints, personal ID, and some other information. She clicked on button, and suddenly her entire screen was filled with a DNA transcript: 

ATTTACGATACCCATAGGACATTACATAGTAGTAGGGATTATGATAGAAGAGTAGAAGTTGAAAAGGGTTTCAATTGAGAGAGTATGAGTGACATGATGGACATCAGTACGTAACGACCGATCAGAAAGTCCGCGCGAGCATCAGTAGCTAT

Wow, Lyra thought. She highlighted random sections of DNA; most of it came up as "non-coding." She didn't know what that meant.

Red warnings flashed across the top of the screen, by Lyra didn't read them.


***

"Can't they just give me a goddamn answer?" Tee fumed. "Elders almighty, first they turn us around with no warning, break half the controls and get six men in the medbay, and no one knows what the hell is going on!" He stormed back into the bunk room and sat on the bed. Lyra stared.

"What's happened?" she asked.

"Nothing, that's the problem! According to all instrument readouts, every screen, every computer that's hooked up, absolutely nothing is wrong!"

"But that means-" Lyra began, but Tee cut her off.

"What the hell are you doing on mine, anyway?"

Lyra shrugged and scooted away anxiously. "Nothing, I swear. I just wanted to see how it worked."

"You're playing with DNA transcripts!" Tee yelled. Ace peeked his head into the room curiously and sighed. 

"Tee, so what? You're so dramatic."

"You don't play with DNA transcripts," Tee said darkly. "Dalia taught me that much."

"Who is Dalia, anyway?" Lyra asked. "That's the third time you've mentioned her."

"Acidalia Planitia. The woman you lied about being in an underground bar."

"The Cipher," Lyra agreed. "Why do you call her Dalia? I know you aren't supposed to. And what about the Centurion crash? What is the Centurion?"

"It's complicated. Are you a Loyalist?"

Lyra shook her head. "They're the crazies that want to take down the government, right?"

"Sort of," Tee said. "Our problem with the Loyalists is that they claim the current system is ineffective and wrong-"

"Well, wrong, yeah," Lyra said. "But you have to admit it works."

"Right. Well, they claim it doesn't, and they want to change that. At the same time, though, they don't want to make it better."

"What do you mean?" Lyra asked. 

"Well, you know how the power is kept in the Cipher, Generalis and Dictatoria lineage?" Tee asked. "Generalis is the army, Dictatoria is the propaganda and the front, and Ciphers have the real power. It's like a corrupt, twisted version of what it was originally meant to be- a government with three branches that keep each other in check. This was thousands upon thousands of years ago, when people could choose their government."

"How did that work?" Lyra asked.

Tee shrugged. "I don't know. And remember, I'm a soldier. All this information I got from Dalia."

"All right, keep going."

"Anyway, that was the system the Great Elders set up. They were the original founders of Eleutheria."

"I know, I'm not dumb," Lyra said. "Uneducated- maybe. I'll give you that. But not dumb."

"Okay, fine," Tee said. "But the Elders set up a similar system in Eleutheria. The people could pick who they wanted to represent them. Maybe they all got together and made a decision, maybe they all voted, maybe they stood together at the courthouses and yelled who they wanted. It doesn't matter. Point is, they had the freedom of choice. And I should mention that these people had the power to do whatever they wanted, too. No castes or anything like that."

"Then how did it get this screwed up?" Lyra asked.

"Well, eventually the same families started being the ones to control everything," Tee said. "And this happened before Eleutheria even started, in the country the Elders came from. It was destroyed, of course- there was a pandemic that wiped out nearly everyone on the planet, and all the survivors congregated at Eleutheria, including them. So they basically said, we have to put a stop to this, and they did, but it always rose back up again."

"Human nature," Ace added from the doorway.

"Right. Human nature. So this happened until it was an oli- olgi- oligarchy, I think- where certain families ruled everything and no one else had any say in it. And it evolved into this mess. And then the war started, but you wouldn't know anything about that."

"I want to," Lyra said.

"You have to understand that if I tell you anything about the war, you'll be in serious trouble. We'll both be executed."

"I have a feeling you're already in danger of that, and that I'm not the first person you've told this to," she sighed.

"Fine. You know how the government always says there was life out there, and we killed them all so they aren't a threat anymore?"

Lyra nodded.

"We didn't kill them all, and they're still a threat," Tee sighed. "And the Loyalists know this."

"You never did tell me why you hate them," she pointed out. "You told me a ton of history facts, which, cool, but not anything about them."

"They want to go back to an oligarchy where certain families rule and everyone else has the illusion of freedom, but the power is still up there. We would have beat them already, if it weren't for this damned war."

"What are the aliens doing that stops you from stopping them?"Lyra asked. She shook her head. "Wow, this is complicated."

"The problem is that we can't take them down, redo the government and make a mess right now, because it would make it easier for them to invade us in a power vacuum," Tee said.

"So you can't do anything," Lyra sighed. "Because of you did, Eleutheria would fall apart, and aliens could come destroy the planet?"

"Yeah," Ace said. "I mean, well, yeah. You're taking this well."

"You're the first who didn't freak out," Tee said.

Lyra shrugged. "I don't really care about Eleutheria, no offense. Yeah, I'm from there, but what has it ever done for me? And you?"

"I don't know," Ace confessed. "I love it. It's the motherland. There's something that happens when you stand on top of the towers and stare at it- look at all those neon lights, I mean. It's so busy, organized. Of course, it's corrupt completely, but you can't see that from the surface. On the surface it's all just glowing and sparkling, and there's just something about it, you know?"

"It's like it's programmed into me," Tee sighed. "It probably is- everything is, but I can't help it. I'd do anything for Eleutheria, and that includes joining a dangerous rebellion and risking my life to fix its broken system."

"I've never felt like that," Lyra replied. "I spent all my life underground. There was nothing there for me but a certain future in either being a nobody Cantantor or a druggie. The best I could ever hope for was living fast and dying young without becoming an addict. Did you know the buildings are so tall on ground level you can't even make out the sky? I haven't even seen the stars before."

"You haven't seen the sky?" Ace asked. "Elders almighty. I'll take you, right now, if you want."

"You will?" Lyra asked. "That'd be perfect!"

Something dinged on Tee's computer. "Yeah, you guys go. Look at the stars or whatever. Have fun."

"Coming?" Ace asked.

"Nah," he replied. "Busy. I just want to check something out for a minute."

Ace and Lyra disappeared through the doorway and ran down the corridor, Ace covering her with a cape in a bad attempt to make her bubblegum hair less noticeable. Tee went over to the screen.

The tracking software he'd installed covertly had intercepted a message. 

SGFycHN0cmluZy0gdGhlIHRpbWUgaXMgdXBvbiB1cy4gQXJjaGFuZ2VsIHdpbGwgc2V0IHlvdSBmcmVlLiBUaGUgQWxiYXRyb3NzIHdpbGwgYmUgdW5kZXIgbXkgY29udHJvbCBieSB0b25pZ2h0LiBUcnVzdCB0aGUgc2VyYXBoaW0uIFRoZSBDaXBoZXJzIG11c3QgZmFsbC4gTG9uZyBsaXZlIHRoZSBtb3ZlbWVudC4=

What? Tee thought. From TB-2116M to an unknown Eleutherian communicator cuff. 

It seemed to be gibberish, but it wasn't in any sort of code Tee recognized. The Movement had something of a thing for using outdated computer terminology that hadn't been used since the 28th century, but this- this wasn't binary, as far as Tee knew. Too many numbers and letters. He didn't think it was hexadecimal either. Quickly, he ran through the bases in his head; it was difficult for someone who'd been programmed to fight and kill instead of learn, but he'd memorized up to thirty.

Not binary, ternary, not octal or hexadecimal or even octadecimal. Tee thought back to the ancient ways of computer programming. They used bases of 8, right? Not octal. Not hex. Base 32? No, not quite- 64. That was it. It had to be 64.

Sure enough, he plugged in the translator from 64 to Eleutherian Latin Basic and it began working. 

Harpstring- the time is upon us. Archangel will set you free. The Albatross will be under my control by tonight. Trust the seraphim. The Ciphers must fall. Long live the movement.

He was planning a mutiny. It had failed. The autopilot had overridden his hacking attempts. But Harpstring, Archangel, Seraphim- those had to be code names, had to be. Not only was TB now confirmed to be a member of the movement, he was actively working with other people. 

This he had to tell Dalia. He'd have preferred to do it in person, but this was urgent and he wouldn't be anywhere near Eleutheria for weeks.

He picked up his own communicator and typed out a message. The revolutionaries like them weren't nearly as dramatic as those of the Movement, preferring straightforward but more encrypted messages over pretentious codenames.

Dalia, he wrote. This is your brother. TB- you know the one- attempted a mutiny today. It failed. Guess they aren't as good at hacking as their fancy terminology makes them seem. He sent a message- "Harpstring- the time is upon us. Archangel will set you free. The Albatross will be under my control by tonight. Trust the seraphim. The Ciphers must fall. Long live the movement." I don't know what it references or who it's sent to. There's a girl here named Lyra, Cantator, who has connections to a Cuencia named Athena, who has connections to someone named Carina- she snuck onto my ship after swindling Athena into believing she knows you as a way to get off the planet. I'm leaving her with Seren on Mars. I'll talk to you later. Tell me if you find anything.

He translated the message into the ancient language he'd agreed upon with his sister, surely a bad translation but she'd get the gist of it. 

Далия, ТБ - вы знаете, что сегодня один попытался вызвать мятеж. Это не удалось. Полагаю, они не так хороши в взломе, как их замысловатая терминология заставляет их казаться. Он послал сообщение: «Гарпстринг - время настало. Архангел освободит вас. К вечеру Альбатрос будет под моим контролем. Доверьтесь серафимам. Шифры должны падать. Да здравствует движение. «Я не знаю, на что он ссылается или кого он посылает. Здесь есть девушка по имени Лира, Кантор, которая имеет связи с Куэнсией по имени Афина, которая имеет связи с кем-то по имени Карина, - она ​​пробралась на мой корабль после того, как надула Афину, полагая, что знает тебя как способ сойти с планеты. Я оставляю ее с Сереном на Марсе. Поговорим позже. Скажите, если вы найдете что-нибудь

He encrypted the data and sent it off with a whoosh. Another of the Movement's plans foiled. Now, to deal with Lyra.

Author's Note

That is indeed real base-64! Alternative numerical systems are rad. (And the language at the end is Russian, in case you couldn't tell. Eureka takes place about three thousand years in the future, and most languages, including English, are dead. They speak a language I call "Spanglishitalatineek-" a mixture of Spanish, English, Italian, Greek and Latin. The chapter names are all in Latin, as are most of the other names. 

Join MovellasFind out what all the buzz is about. Join now to start sharing your creativity and passion
Loading ...